Review



t7 dna template  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    New England Biolabs t7 dna template
    T7 Dna Template, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 496 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+DNA+Polymerase/pmc12927048-120-1-13
    Average 96 stars, based on 496 article reviews
    t7 dna template - by Bioz Stars, 2026-09
    96/100 stars

    Images

    Related Articles

    Generated:

    Article Title: Multi-omics analysis of arboviral capsids targets in mosquitoes reveals a pro-viral function of the chromatin-remodeling Brahma complex.
    Article Snippet: Search results were filtered with a false discovery rate of 0.01 for peptide and protein identification. dsRNA synthesis Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5’-TTTTTTTTTTTTTTTTTTTTVN-3’). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5’-ends (full primer sequences in Supplemental Table S1). ..

    Article Title: Multiomics Analysis of Arboviral Capsid Targets in Mosquitoes Reveals a Proviral Function of the Chromatin-Remodeling Brahma Complex
    Article Snippet: Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity Complementary DNA (cDNA) Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5′-TTTTTTTTTTTTTTTTTTTTVN-3′). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5′-ends (full primer sequences are provided in ). ..

    Polymerase Chain Reaction:

    Article Title: Multi-omics analysis of arboviral capsids targets in mosquitoes reveals a pro-viral function of the chromatin-remodeling Brahma complex.
    Article Snippet: Search results were filtered with a false discovery rate of 0.01 for peptide and protein identification. dsRNA synthesis Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5’-TTTTTTTTTTTTTTTTTTTTVN-3’). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5’-ends (full primer sequences in Supplemental Table S1). ..

    Article Title: Multiomics Analysis of Arboviral Capsid Targets in Mosquitoes Reveals a Proviral Function of the Chromatin-Remodeling Brahma Complex
    Article Snippet: Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity Complementary DNA (cDNA) Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5′-TTTTTTTTTTTTTTTTTTTTVN-3′). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5′-ends (full primer sequences are provided in ). ..

    Sequencing:

    Article Title: Multi-omics analysis of arboviral capsids targets in mosquitoes reveals a pro-viral function of the chromatin-remodeling Brahma complex.
    Article Snippet: Search results were filtered with a false discovery rate of 0.01 for peptide and protein identification. dsRNA synthesis Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5’-TTTTTTTTTTTTTTTTTTTTVN-3’). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5’-ends (full primer sequences in Supplemental Table S1). ..

    Article Title: Multiomics Analysis of Arboviral Capsid Targets in Mosquitoes Reveals a Proviral Function of the Chromatin-Remodeling Brahma Complex
    Article Snippet: Total cellular Aag2 RNA was extracted using TRIzol (Invitrogen) as recommended by the manufacturer and reverse transcribed following the High-Capacity Complementary DNA (cDNA) Reverse Transcription Kit (Applied Biosystems) manufacturer’s protocol using oligo dT primers (sequence: 5′-TTTTTTTTTTTTTTTTTTTTVN-3′). .. The T7-DNA template for dsRNA synthesis was generated by PCR with Phusion polymerase (New England Biolabs) using 100 ng cDNA with target-specific forward and reverse primers containing the T7 RNA polymerase promoter sequence (GTAATACGACTCACTATAGGG) at the 5′-ends (full primer sequences are provided in ). ..



    Similar Products

    96
    New England Biolabs t7 dna template
    T7 Dna Template, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+DNA+Polymerase/pmc12927048-120-1-13
    Average 96 stars, based on 1 article reviews
    t7 dna template - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs dna template
    Dna Template, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+RNA+Polymerase/pm42087788-37-32-41
    Average 99 stars, based on 1 article reviews
    dna template - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    95
    Vazyme Biotech Co double stranded dna templates
    Double Stranded Dna Templates, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+RNA+Polymerase/pm42061542-65-6-13
    Average 95 stars, based on 1 article reviews
    double stranded dna templates - by Bioz Stars, 2026-09
    95/100 stars
      Buy from Supplier

    99
    New England Biolabs dna templates
    Dna Templates, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+RNA+Polymerase/pmc13004955-210-7-32
    Average 99 stars, based on 1 article reviews
    dna templates - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    96
    TaKaRa trna template dna
    (A) Schematic of 21 tRNAs synthesis by the <t>tRNA</t> array method. The 21 tRNA genes are divided into five groups and encoded in a single <t>DNA</t> template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).
    Trna Template Dna, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+RNA+Polymerase/bio_rxiv__64898__2026__01__06__697847-149-3-9
    Average 96 stars, based on 1 article reviews
    trna template dna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    99
    New England Biolabs trna template dna
    (A) Schematic of 21 tRNAs synthesis by the <t>tRNA</t> array method. The 21 tRNA genes are divided into five groups and encoded in a single <t>DNA</t> template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).
    Trna Template Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/t7+dna+template/T7+RNA+Polymerase/bio_rxiv__64898__2026__01__06__697847-149-3-12
    Average 99 stars, based on 1 article reviews
    trna template dna - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    (A) Schematic of 21 tRNAs synthesis by the tRNA array method. The 21 tRNA genes are divided into five groups and encoded in a single DNA template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of 21 tRNAs synthesis by the tRNA array method. The 21 tRNA genes are divided into five groups and encoded in a single DNA template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Purification, Synthesized, Luciferase, Fluorescence, Activity Assay, Enzymatic Assay

    (A, C, E) Minimum free energy (MFE) secondary structures of tRNA Ile (A), tRNA Asn (C), and tRNA Pro (E) variants predicted using ViennaRNA . (B, D, F) Translation activity assays of tRNA Ile (B), tRNA Asn (D), and tRNA Pro (F) variants. Translation reactions were performed in the tfPURE system (composition A) containing a 20-tRNAs mixture (500 ng/μL) lacking the target tRNA, one of the target tRNA variants (tRNA Ile or tRNA Asn at 13 ng/μL, tRNA Pro at 25 ng/μL), a DNA template encoding luciferase (1 nM), and T7 RNA polymerase (0.42 U/μL). Reactions were incubated at 30 °C for 16 h and luciferase activity was measured. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A, C, E) Minimum free energy (MFE) secondary structures of tRNA Ile (A), tRNA Asn (C), and tRNA Pro (E) variants predicted using ViennaRNA . (B, D, F) Translation activity assays of tRNA Ile (B), tRNA Asn (D), and tRNA Pro (F) variants. Translation reactions were performed in the tfPURE system (composition A) containing a 20-tRNAs mixture (500 ng/μL) lacking the target tRNA, one of the target tRNA variants (tRNA Ile or tRNA Asn at 13 ng/μL, tRNA Pro at 25 ng/μL), a DNA template encoding luciferase (1 nM), and T7 RNA polymerase (0.42 U/μL). Reactions were incubated at 30 °C for 16 h and luciferase activity was measured. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Activity Assay, Luciferase, Incubation

    (A) Schematic of the HDVR self-cleaving assay of PIEN group constructs. Transcription was performed using templates with different tRNA orders in the absence of RNase P, and the resulting transcripts were analyzed by urea-PAGE. (B) Urea-PAGE analysis of transcripts from PIEN group constructs, followed by SYBR Green II staining. Predicted bands corresponding to transcripts containing HDVR and those lacking HDVR are indicated by blue and yellow arrowheads, respectively. (C) Schematic of the experimental workflow for the RNase P digestion assay. Prepared pre-tRNAs (250 nM) lacking HDVR were used as substrates and incubated with RNase P (500 nM M1 RNA and 750 nM C5 protein) in buffer R (see Methods). (D) Urea-PAGE analysis of the digestion products, followed by SYBR green II staining. Individually prepared PIEN tRNA mixtures were included as size controls. Undigested pre-tRNA species are indicated by red arrows.

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of the HDVR self-cleaving assay of PIEN group constructs. Transcription was performed using templates with different tRNA orders in the absence of RNase P, and the resulting transcripts were analyzed by urea-PAGE. (B) Urea-PAGE analysis of transcripts from PIEN group constructs, followed by SYBR Green II staining. Predicted bands corresponding to transcripts containing HDVR and those lacking HDVR are indicated by blue and yellow arrowheads, respectively. (C) Schematic of the experimental workflow for the RNase P digestion assay. Prepared pre-tRNAs (250 nM) lacking HDVR were used as substrates and incubated with RNase P (500 nM M1 RNA and 750 nM C5 protein) in buffer R (see Methods). (D) Urea-PAGE analysis of the digestion products, followed by SYBR green II staining. Individually prepared PIEN tRNA mixtures were included as size controls. Undigested pre-tRNA species are indicated by red arrows.

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Construct, SYBR Green Assay, Staining, Incubation

    (A) Design of the improved PIEN construct (L_PIEN_v2), in which tRNA Pro , tRNA Ile , and tRNA Asn were replaced with the higher-activity variants (tRNA Pro _G1C_U40A_C16A, tRNA Ile _G16A, and tRNA Asn _C17G, respectively) and a leader sequence was inserted upstream of tRNA Pro . (B) Urea-PAGE analysis of transcripts generated from the previous construct (PIEN_v1) and L_PIEN_v2 templates, followed by SYBR green II staining. Predicted bands corresponding to the uncleaved transcript containing HDVR and the transcript after self-cleavage of HDVR are indicated by yellow and blue arrows, respectively. (C) Schematic of translation assay using PIEN tRNAs. Reactions were performed in tfPURE (composition B) supplemented with the tRNA PIEN array template DNA (25 nM), luciferase template DNA (1 nM), RNase P (1 μM M1 RNA and 1.5 μM C5 protein), T4 polynucleotide kinase (0.094 U/μL), T7 RNA polymerase (1.7 U/μL), and 17 IVS tRNAs that lack PIEN tRNAs. After incubation at 30 °C for 24 h, luciferase activity was measured. (D) Measured luciferase activities. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Design of the improved PIEN construct (L_PIEN_v2), in which tRNA Pro , tRNA Ile , and tRNA Asn were replaced with the higher-activity variants (tRNA Pro _G1C_U40A_C16A, tRNA Ile _G16A, and tRNA Asn _C17G, respectively) and a leader sequence was inserted upstream of tRNA Pro . (B) Urea-PAGE analysis of transcripts generated from the previous construct (PIEN_v1) and L_PIEN_v2 templates, followed by SYBR green II staining. Predicted bands corresponding to the uncleaved transcript containing HDVR and the transcript after self-cleavage of HDVR are indicated by yellow and blue arrows, respectively. (C) Schematic of translation assay using PIEN tRNAs. Reactions were performed in tfPURE (composition B) supplemented with the tRNA PIEN array template DNA (25 nM), luciferase template DNA (1 nM), RNase P (1 μM M1 RNA and 1.5 μM C5 protein), T4 polynucleotide kinase (0.094 U/μL), T7 RNA polymerase (1.7 U/μL), and 17 IVS tRNAs that lack PIEN tRNAs. After incubation at 30 °C for 24 h, luciferase activity was measured. (D) Measured luciferase activities. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Construct, Activity Assay, Sequencing, Generated, SYBR Green Assay, Staining, Luciferase, Incubation

    (A) Schematic of translation assays using 21 tRNAs prepared by the translation-uncoupled method. Twenty-one tRNAs were simultaneously expressed using the tRNA array method from a 21-tRNA array version 2, in which the PIEN group was replaced with version 2 variants. The resulting 21-tRNA mixture (240 ng/μL) was purified and added to tfPURE (composition A) together with a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL), followed by incubation at 30 °C for 16 h before activity measurements. (B) Luciferase activities. (C) sfGFP fluorescence. (D) GUS activity. (E) Schematic of translation-coupled in situ synthesis of all 21 tRNAs using tRNA array version 2. Reactions were performed in tfPURE (composition C) supplemented with the 21 tRNA template (50 nM), a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA(1 nM), T7 RNA polymerase (3.4 U/μL), T4 polynucleotide kinase (0.094 U/μL), and RNase P (4 μM M1 RNA and 6 μM C5 protein). When using individually prepared 21 IVS tRNAs (IVS), the concentration was set to 600 ng/μL. After incubation at 30 °C for 24 h, translation activities were measured. (F) Luciferase activities. (G) sfGFP fluorescence. (H) GUS activity. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of translation assays using 21 tRNAs prepared by the translation-uncoupled method. Twenty-one tRNAs were simultaneously expressed using the tRNA array method from a 21-tRNA array version 2, in which the PIEN group was replaced with version 2 variants. The resulting 21-tRNA mixture (240 ng/μL) was purified and added to tfPURE (composition A) together with a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL), followed by incubation at 30 °C for 16 h before activity measurements. (B) Luciferase activities. (C) sfGFP fluorescence. (D) GUS activity. (E) Schematic of translation-coupled in situ synthesis of all 21 tRNAs using tRNA array version 2. Reactions were performed in tfPURE (composition C) supplemented with the 21 tRNA template (50 nM), a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA(1 nM), T7 RNA polymerase (3.4 U/μL), T4 polynucleotide kinase (0.094 U/μL), and RNase P (4 μM M1 RNA and 6 μM C5 protein). When using individually prepared 21 IVS tRNAs (IVS), the concentration was set to 600 ng/μL. After incubation at 30 °C for 24 h, translation activities were measured. (F) Luciferase activities. (G) sfGFP fluorescence. (H) GUS activity. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Purification, Luciferase, Incubation, Activity Assay, Fluorescence, In Situ, Concentration Assay

    (A) Schematic of 21 tRNAs synthesis by the tRNA array method. The 21 tRNA genes are divided into five groups and encoded in a single DNA template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of 21 tRNAs synthesis by the tRNA array method. The 21 tRNA genes are divided into five groups and encoded in a single DNA template. After transcription, five transcripts are processed into mature-sized tRNAs through HDVR self-cleavage and RNase P digestion. (B) Schematic of the supplementation assay. The purified 21 tRNAs (240 ng/μL) synthesized by the tRNA array method and an individually-synthesized additional tRNA mixture (PIEN: 40 ng/μL each; others: 4.7 ng/μL each), corresponding to one of the five groups, were used for translation of three reporter proteins (firefly luciferase, sfGFP, and GUS) in a tRNA-free PURE system (tfPURE; composition A, see Tables S5 and S6) containing reporter-encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL) at 30 °C for 16 h. (C) Luciferase activities. (D) sfGFP fluorescence. (E) GUS activities. GUS activity was quantified by an enzymatic assay after the reaction, and the slope of fluorescence increase over time was used as a measure of activity. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Purification, Synthesized, Luciferase, Fluorescence, Activity Assay, Enzymatic Assay

    (A, C, E) Minimum free energy (MFE) secondary structures of tRNA Ile (A), tRNA Asn (C), and tRNA Pro (E) variants predicted using ViennaRNA . (B, D, F) Translation activity assays of tRNA Ile (B), tRNA Asn (D), and tRNA Pro (F) variants. Translation reactions were performed in the tfPURE system (composition A) containing a 20-tRNAs mixture (500 ng/μL) lacking the target tRNA, one of the target tRNA variants (tRNA Ile or tRNA Asn at 13 ng/μL, tRNA Pro at 25 ng/μL), a DNA template encoding luciferase (1 nM), and T7 RNA polymerase (0.42 U/μL). Reactions were incubated at 30 °C for 16 h and luciferase activity was measured. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A, C, E) Minimum free energy (MFE) secondary structures of tRNA Ile (A), tRNA Asn (C), and tRNA Pro (E) variants predicted using ViennaRNA . (B, D, F) Translation activity assays of tRNA Ile (B), tRNA Asn (D), and tRNA Pro (F) variants. Translation reactions were performed in the tfPURE system (composition A) containing a 20-tRNAs mixture (500 ng/μL) lacking the target tRNA, one of the target tRNA variants (tRNA Ile or tRNA Asn at 13 ng/μL, tRNA Pro at 25 ng/μL), a DNA template encoding luciferase (1 nM), and T7 RNA polymerase (0.42 U/μL). Reactions were incubated at 30 °C for 16 h and luciferase activity was measured. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Activity Assay, Luciferase, Incubation

    (A) Schematic of the HDVR self-cleaving assay of PIEN group constructs. Transcription was performed using templates with different tRNA orders in the absence of RNase P, and the resulting transcripts were analyzed by urea-PAGE. (B) Urea-PAGE analysis of transcripts from PIEN group constructs, followed by SYBR Green II staining. Predicted bands corresponding to transcripts containing HDVR and those lacking HDVR are indicated by blue and yellow arrowheads, respectively. (C) Schematic of the experimental workflow for the RNase P digestion assay. Prepared pre-tRNAs (250 nM) lacking HDVR were used as substrates and incubated with RNase P (500 nM M1 RNA and 750 nM C5 protein) in buffer R (see Methods). (D) Urea-PAGE analysis of the digestion products, followed by SYBR green II staining. Individually prepared PIEN tRNA mixtures were included as size controls. Undigested pre-tRNA species are indicated by red arrows.

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of the HDVR self-cleaving assay of PIEN group constructs. Transcription was performed using templates with different tRNA orders in the absence of RNase P, and the resulting transcripts were analyzed by urea-PAGE. (B) Urea-PAGE analysis of transcripts from PIEN group constructs, followed by SYBR Green II staining. Predicted bands corresponding to transcripts containing HDVR and those lacking HDVR are indicated by blue and yellow arrowheads, respectively. (C) Schematic of the experimental workflow for the RNase P digestion assay. Prepared pre-tRNAs (250 nM) lacking HDVR were used as substrates and incubated with RNase P (500 nM M1 RNA and 750 nM C5 protein) in buffer R (see Methods). (D) Urea-PAGE analysis of the digestion products, followed by SYBR green II staining. Individually prepared PIEN tRNA mixtures were included as size controls. Undigested pre-tRNA species are indicated by red arrows.

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Construct, SYBR Green Assay, Staining, Incubation

    (A) Design of the improved PIEN construct (L_PIEN_v2), in which tRNA Pro , tRNA Ile , and tRNA Asn were replaced with the higher-activity variants (tRNA Pro _G1C_U40A_C16A, tRNA Ile _G16A, and tRNA Asn _C17G, respectively) and a leader sequence was inserted upstream of tRNA Pro . (B) Urea-PAGE analysis of transcripts generated from the previous construct (PIEN_v1) and L_PIEN_v2 templates, followed by SYBR green II staining. Predicted bands corresponding to the uncleaved transcript containing HDVR and the transcript after self-cleavage of HDVR are indicated by yellow and blue arrows, respectively. (C) Schematic of translation assay using PIEN tRNAs. Reactions were performed in tfPURE (composition B) supplemented with the tRNA PIEN array template DNA (25 nM), luciferase template DNA (1 nM), RNase P (1 μM M1 RNA and 1.5 μM C5 protein), T4 polynucleotide kinase (0.094 U/μL), T7 RNA polymerase (1.7 U/μL), and 17 IVS tRNAs that lack PIEN tRNAs. After incubation at 30 °C for 24 h, luciferase activity was measured. (D) Measured luciferase activities. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Design of the improved PIEN construct (L_PIEN_v2), in which tRNA Pro , tRNA Ile , and tRNA Asn were replaced with the higher-activity variants (tRNA Pro _G1C_U40A_C16A, tRNA Ile _G16A, and tRNA Asn _C17G, respectively) and a leader sequence was inserted upstream of tRNA Pro . (B) Urea-PAGE analysis of transcripts generated from the previous construct (PIEN_v1) and L_PIEN_v2 templates, followed by SYBR green II staining. Predicted bands corresponding to the uncleaved transcript containing HDVR and the transcript after self-cleavage of HDVR are indicated by yellow and blue arrows, respectively. (C) Schematic of translation assay using PIEN tRNAs. Reactions were performed in tfPURE (composition B) supplemented with the tRNA PIEN array template DNA (25 nM), luciferase template DNA (1 nM), RNase P (1 μM M1 RNA and 1.5 μM C5 protein), T4 polynucleotide kinase (0.094 U/μL), T7 RNA polymerase (1.7 U/μL), and 17 IVS tRNAs that lack PIEN tRNAs. After incubation at 30 °C for 24 h, luciferase activity was measured. (D) Measured luciferase activities. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Construct, Activity Assay, Sequencing, Generated, SYBR Green Assay, Staining, Luciferase, Incubation

    (A) Schematic of translation assays using 21 tRNAs prepared by the translation-uncoupled method. Twenty-one tRNAs were simultaneously expressed using the tRNA array method from a 21-tRNA array version 2, in which the PIEN group was replaced with version 2 variants. The resulting 21-tRNA mixture (240 ng/μL) was purified and added to tfPURE (composition A) together with a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL), followed by incubation at 30 °C for 16 h before activity measurements. (B) Luciferase activities. (C) sfGFP fluorescence. (D) GUS activity. (E) Schematic of translation-coupled in situ synthesis of all 21 tRNAs using tRNA array version 2. Reactions were performed in tfPURE (composition C) supplemented with the 21 tRNA template (50 nM), a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA(1 nM), T7 RNA polymerase (3.4 U/μL), T4 polynucleotide kinase (0.094 U/μL), and RNase P (4 μM M1 RNA and 6 μM C5 protein). When using individually prepared 21 IVS tRNAs (IVS), the concentration was set to 600 ng/μL. After incubation at 30 °C for 24 h, translation activities were measured. (F) Luciferase activities. (G) sfGFP fluorescence. (H) GUS activity. Error bars indicate standard deviations (N = 3).

    Journal: bioRxiv

    Article Title: Enhanced tRNA array method version 2 for simultaneous in vitro synthesis of 21 tRNAs

    doi: 10.64898/2026.01.06.697847

    Figure Lengend Snippet: (A) Schematic of translation assays using 21 tRNAs prepared by the translation-uncoupled method. Twenty-one tRNAs were simultaneously expressed using the tRNA array method from a 21-tRNA array version 2, in which the PIEN group was replaced with version 2 variants. The resulting 21-tRNA mixture (240 ng/μL) was purified and added to tfPURE (composition A) together with a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA template (1 nM) and T7 RNA polymerase (0.42 U/μL), followed by incubation at 30 °C for 16 h before activity measurements. (B) Luciferase activities. (C) sfGFP fluorescence. (D) GUS activity. (E) Schematic of translation-coupled in situ synthesis of all 21 tRNAs using tRNA array version 2. Reactions were performed in tfPURE (composition C) supplemented with the 21 tRNA template (50 nM), a reporter gene (luciferase, sfGFP, or GUS)–encoding DNA(1 nM), T7 RNA polymerase (3.4 U/μL), T4 polynucleotide kinase (0.094 U/μL), and RNase P (4 μM M1 RNA and 6 μM C5 protein). When using individually prepared 21 IVS tRNAs (IVS), the concentration was set to 600 ng/μL. After incubation at 30 °C for 24 h, translation activities were measured. (F) Luciferase activities. (G) sfGFP fluorescence. (H) GUS activity. Error bars indicate standard deviations (N = 3).

    Article Snippet: The concentrations of tRNA template DNA, T7 RNA polymerase (Takara), T4 PNK (New England Biolab), and RNase P were adjusted depending on the experimental design and are specified in the corresponding figure legends.

    Techniques: Purification, Luciferase, Incubation, Activity Assay, Fluorescence, In Situ, Concentration Assay